PatSearch_test
This is a test of the PatSearch service.
Test filesDownload the files for this test
Test runRun test now
Support reference#1642-1891
Show/hide recent test logs
view log 6 days agoFAILED
Test began: 2012-05-13 05:43:38 Test ended: 2012-05-13 05:43:54 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 3 weeks agoFAILED
Test began: 2012-05-01 18:59:07 Test ended: 2012-05-01 18:59:22 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 4 weeks agoFAILED
Test began: 2012-04-21 09:06:12 Test ended: 2012-04-21 09:06:28 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 1 month agoFAILED
Test began: 2012-04-18 06:13:44 Test ended: 2012-04-18 06:13:45 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 1 month agoFAILED
Test began: 2012-04-11 21:57:01 Test ended: 2012-04-11 21:57:02 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 1 month agoFAILED
Test began: 2012-04-10 18:49:26 Test ended: 2012-04-10 18:49:27 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 1 month agoFAILED
Test began: 2012-04-07 06:15:55 Test ended: 2012-04-07 06:15:56 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 2 months agoFAILED
Test began: 2012-03-27 04:50:16 Test ended: 2012-03-27 04:50:16 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 2 months agoFAILED
Test began: 2012-03-17 16:19:54 Test ended: 2012-03-17 16:19:55 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
view log 2 months agoFAILED
Test began: 2012-03-14 03:42:06 Test ended: 2012-03-14 03:42:06 Result : Test failure ------ stderr and stdout follow ------ Operation in progress at /Library/Perl/5.8.8/darwin-thread-multi-2level/XML/LibXML.pm line 587. Retriving and processing the WSDL and the XSDs imported Caught an exception Could not create file parser context for file "http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch?wsdl": No such file or directory at ./patsearch_test3.pl line 20Download this log...
This test consists of the following files:
patsearch_test3.pl
#!/usr/bin/perl -w
use XML::Compile::WSDL11;
use XML::Compile::Transport::SOAPHTTP;
use strict;
####
eval {
my $inputs = {
'sequence' => { 'input_direct_data' => 'ttcacactccgtttttgcgcactcgattggcattcttagtgatgtgagctccgtgttagtggtgaaccttgtgttattcatttgagctcaagtcttggctgtgtgtgtgcgtattgcta'},
'command' => { 'command_direct_data' => 'tgatgtga'}
};
my $serviceendpoint =
'http://spank.ba.itb.cnr.it:8080/soaplab2/typed/services/itba.patsearch';
print "Retriving and processing the WSDL and the XSDs imported\n";
my $wsdl = XML::LibXML->new->parse_file( $serviceendpoint . '?wsdl' );
my $proxy = XML::Compile::WSDL11->new($wsdl);
foreach my $schema ( 1, 2, 3 ) {
my $xsdXml =
XML::LibXML->new->parse_file( $serviceendpoint . '?xsd=' . $schema );
$proxy->schemas->importDefinitions($xsdXml);
}
print "Generating a request message based on the WSDL\n";
my $runAndWaitFor = $proxy->compileClient('runAndWaitFor');
print "Calling the service and getting the response\n";
my ( $answer, $trace ) = $runAndWaitFor->( $inputs );
# &printTrace($trace);
my %answer = %{$answer};
my %answer_ = %{ $answer{'runAndWaitForResponse'} };
my $report = $answer_{'report'};
my $detailed_status = $answer_{'detailed_status'};
my $outfile = $answer_{'output'};
my $outfile_url = $answer_{'output_url'};
print "\nSoaplab report received:\n----------------------------\n\n$report\n";
if ( $detailed_status == 0 ) {
print "Passed\n";
exit 0;
}
print "Failed\n";
exit 1;
};
if ($@) {
print "Caught an exception\n" . $@;
exit 1;
}
# Print request/response trace
sub printTrace($) {
my $trace = shift;
$trace->printTimings;
$trace->printRequest;
$trace->printResponse;
}
# File to String
sub file2String($) {
my $fname = shift;
open FILE, $fname or die "Couldn't open file: $!";
my $fcontent = join( "", <FILE> );
close FILE;
return $fcontent;
}
»
- Login to post comments